Premium Essay

Mastery Problem 1

In: Business and Management

Submitted By ezhasmin
Words 271
Pages 2
Donald Banking Company
Balance Sheet
As of January 31, 2010

Total Assets millions Assets
Cash
Accounts receivable
Other assets
Total Current Assets
Plant and Equipment
Investment assets
Net Fixed Assets
Total assets

as of January 31, 2010

2.10
0.90
14.40
17.40
1.90
169.60
171.50

9%

Total Current Assets
Net Fixed Assets

188.90
91%

Liabilities and Owner's Equity
Total Current Liabilities
Long-term debt
Total Liabilities
Common stock
Retained earnings
Total Shareholders Equity

151.10
2.80
153.90
14.00
21.00
35.00

Total Current Assets
As of January 31, 2010
3%
6%

Total Liabilities & Equity

188.90

Cash
Accounts receivable

50%
41%

Other assets
Total Current Assets

Total Assets

0.90

As of January 31, 2010
2.10

14.40

17.40

1.90

Cash
Accounts receivable

al Current Assets

Other assets

171.50

Total Current Assets

Fixed Assets
169.60

Plant and Equipment
Investment assets
Net Fixed Assets

Net Fixed Assets
As of January 31, 2010
1%

Plant and Equipment

ounts receivable

Investment assets

al Current Assets
99%

Donald Banking Company
Balance Sheet
As of January 31, 2010 millions Sales
Gross Profit
Fixed expense
Other expense
EBIT
Interest expense
Earnings Before Taxes
Taxes
Net Income

Notes:
Taxes

37.80
37.80
17.70
6.90
13.20
0.80
12.40
0.00

12.40

no data

Donald Banking Company
Donald Banking Company
Balance Sheet
As of January 31, 2010 millions Retained earnings at January 31, 2009
Plus: Net Income
Less: Dividends paid to shareholders
Retained earnings at January 31, 2010

8.60
12.40
0.00
21.00…...

Similar Documents

Premium Essay

Practice-Problem-1

...Practice problems – Set I 1. A bank classifies borrowers as high-risk or low-risk. Only 15% of its loans are made to those in high-risk category. Of all its loans, 5% are in default, and 40% of those in default were made to high-risk borrowers. What is the probability that a high-risk borrower will default? 2. A fund manager is considering investing in the stock of a healthcare provider. The manager’s assessment of probabilities of the rates of return on this stock over the next year is summarized in the table below. Rate of return Less than -10% -10% to 0% 0% to 10% 10% to 20% More than 20% Probability 0.04 0.14 0.28 0.33 0.21 Let A be the event “Rate of return will be more than 10%,” and B be the event “Rate of return will be negative.” • Find the probability of events A and B. • Describe the even that is complement of event A. • Find the probability of the complement of A. • Describe the even that is complement of event B. • Find the probability of the complement of B. • Describe and find the probability of event that is intersection of A and B. • Describe and find the probability of event that is union of A and B. • Are events A and B mutually exclusive? Collectively exhaustive? 3. A random sample of 52 personal property insurance policies showed the following number of claims over the last year: # of claims 0 1 2 3 4 5 6 # of policies 21 15 5 4 2 3 2 • Find the mean number of claims per day. • Find the sample variance and standard......

Words: 413 - Pages: 2

Premium Essay

Sub Problem 1

...Sub Problem 1 The purpose of this survey is too gather information from citizens, business, and educators of the surrounding communities that make-up Hardin to see if there is a need for higher education by identifying those potential students that have an interest in obtaining an Undergraduate or Graduate degree. The group hypothesis is “individuals with a higher education level will perceive a greater need for adult higher education than those with lower education levels”. The null hypothesis is “individuals with a higher educational level will not perceive a greater need for adult higher education than those with lower education levels”. According to the 2010 census, Hardin County has an estimated population of approximately 107,456. 18.5% of Hardin County population has a bachelor degree in the age group of 25 plus, which is approximately 2% below the state average. Within the same age range the county high school graduation rate is 87.4% which is 6% above the state average. The census data clearly shows that there is a large group of applicants within the area that the university can recruit. The survey questions was developed in conjunction with Webster University representative Dr. Brian Daly to help the group obtain the necessary information that will allow the team to submit recommendations that will increase the Undergraduate and Graduate student body population at Webster University Radcliff campus. All questions where inputted into Survey Monkey and the......

Words: 493 - Pages: 2

Premium Essay

Mba510 Problem Set 1

...Week 3 Problem Set 1: Chapter 3: 62, 72 62) The Citizens Banking Company is studying the number of times the ATM located in a Lob laws Supermarket at the foot of Market Street is used per day. Following are the numbers of times the machine was used over each of the last 30 days. Determine the mean number of times the machine was used per day. 83 64 84 76 84 54 75 59 70 6163 80 84 73 68 52 65 90 52 7795 36 78 61 59 84 95 47 87 60 Answer: The ATM machine was used a mean number of times 70. 53. 72.) The weights (in pounds) of a sample of five boxes being sent by UPS are: 12, 6, 7, 3, and 10. 1. Compute the range. 3-12 2. Compute the mean deviation. 7.6 3. Compute the standard deviation. Chapter 5, 66 66) A survey of undergraduate students in the School of Business at Northern University Revealed the following regarding the gender and majors of the students: Major Gender Accounting Management Finance Total |Gender |Accounting |Major/management |Finance |Total | |Male |100 |150 |50 |300 | |Female |100 |50 |50 |200 | |Total |200 |200 |100 |500 ......

Words: 478 - Pages: 2

Premium Essay

Assignment 1 Problem Answers

...Unit 1 Assignment 1 Problems Chapter 1: Problem 5, A-D, Page 21 Chapter 3: Problem 7, A-D, Page 68 Angela Besler Capella University MBA6008 January 12, 2014 Unit 1 Assignment 1 Problems Chapter 1: Problem 5, A-D, Page 21 A. Table and Graph: Types of Production |   | Automobiles | Forklifts | | 0 | 30 | A | Production Alternatives | 2 | 27 | B | | 4 | 21 | C | | 6 | 12 | D | | 8 | 0 | E | | A production possibility “curve displays the different combinations of goods and services that society can produce in a fully, employed economy, assuming a fixed availability of supplies of resources and fixed technology” (McConnell and Et. Al., 2012). The specific assumptions that a production possibilities curve has is that of: * Full employment: employing all available resources * Fixed resources: quantity/quality of production factors fixed * Fixed technology: methods used to produce output(state of technology) constant * Two goods: economy produce only two goods; both consumer and capital goods (McConnell and Et. Al., 2012). “Each point on the curve represents some maximum output of two products” (McConnell and Et. Al., 2012). “Gross Domestic Production (GDP is the total market value of all final goods/services produced annually within boundaries of US, whether by US or foreign supplied resources” (McConnell and Et. Al., 2012). “Net Domestic Production (NDP) is the GDP less part of the year’s output that needed to......

Words: 1236 - Pages: 5

Premium Essay

Financial Problem Part 1

...Financial Reporting Problem, Part 1 ACC/290 April 20, 2014 Abstract In this paper we will discuss Walmart’s Balance sheet and Income Statement. We will analyze the company’s total assets at the end of the most recent annual reporting year and to why it is important. We then will talk about the company’s total assets, how much cash and cash equivalents did the company have, as well as, the amount of accounts payable at the most recent year, and from the previous year. What the company’s net revenues are from the last three annual reporting periods, the change in dollars in the company’s net income from the most recent annual reporting period to the previous annual reporting period. We will talk about the company’s total assets at the end of the most recent year and the previous year from the annual reporting period. Lastly, we will discuss as to what information that has been obtained within this paper that would be important to a potential investor, employee and so forth. Financial Reporting Problem, Part 1 Total Assets The total assets for Wal-Mart as of January 31, 2013 were $203,105,000. The reason this is important for a company or business to know, is so the business can have a better understanding of how much the company is worth. Knowing how much a company is worth is beneficial because the assets can be used as collateral for a loan. Also knowing the assets and comparing total assets to previous...

Words: 1403 - Pages: 6

Premium Essay

Finance Questions and Problems-1

...The Financial Environment: Questions & Problems Questions 2.1, 2.2, 2.3, 2.6, 2.8; Problems: 2.1, 2.5 2.1 The three primary forms of businesses are: Proprietorship, Partnership, and Corporation. Benefits: Proprietorship: Easy to create form a legal perspective, inexpensive to create, subject to few governmental regulations Partnership: Low cost and easy to form, income is taxed as personal and not corporate. Corporation: Corporations have unlimited life, easy to transfer ownership, owners have limited liability. Disadvantages of proprietorship and partnership: Selling interest is difficult, owners have unlimited liability, the life of the business is limited to the life of the owners, restricted to small business status. Disadvantages of Corporations: Double taxation, time consuming and costly to set-up the corporation and file periodic reports. 2.2 Differences: Investor owned vs. not for profit: Investor owned: Individulas become owners when they purchase shares of common stock, shares can be either publicly held or privately held, stockholders have the right of control, a claim to residula earnings, and a claim on liquidation proceeds. Not-for-profit corporations: are tax exempt, run exclusively for the public - profits are not used for private gain, no single......

Words: 616 - Pages: 3

Premium Essay

Unit 1. Problem Set 1. Unit 1 Problems

...Fill in the blank Page 24 1. The general Public in the United States will be able to purchase all of the Windows 7 editions in retail stores except starter, home basic, and enterprise. 2. The core module that provides all of the Windows 7 capability that isn’t language- or edition specific is called minwin. 3. When you copy a file to a library, Windows Explorer writes the file to the folder designated as the save location. 4. To use federated search, you must download or create XML files for specific sites called search connectors. 5. The only operating system edition that you can upgrade in-place to Windows 7 Professional is windows vista business. 6. Upgrading a computer running Windows 7 Starter to Windows 7 Ultimate using Windows Anytime Upgrade requires 0 megabytes of additional hard disk space. 7. To migrate a computer running Windows XP to Windows 7, you can use a utility called user state migration tool. 8. The new Windows 7 feature that renders all of the windows on the desktop transparent when you mouse over the right end of the taskbar is called aero peek. 9. The Windows 7 Starter edition is only available in a 32-bit version. 10. The maximum amount of system memory supported by Windows 7 Enterprise is 192 GB (64bit). Fill in the blank page 61 1. side-by-side, wipe-and-load 2. Windows recovery environment 3. windows easy transfer, USMT 4. 72 hours of continuous operation 5. floppy disks 6.......

Words: 267 - Pages: 2

Free Essay

Problem Set 1

...Problem Set 1 MGT-309 – Intro to Logistics Management November 23, 2014 Cosme Lucio Professor Jerry Bilbrey 2a. 2*8*44,000=704,000 .12*.75=.09 704,000/.09= 7,822,222.222222222 = 2796.823595120404 = 2797 2b. Inventory Carrying Costs = (2,797/2)*0.75*12% = $125.87 Order Costs = (44,000/2797) = 15.73 = 16, 16*$8(per order) = $128.00 Transportation Costs = 44,000 units *0.05 per unit = 2,200 (Q=2,797) = 125.87+128+2,200= 2453.87 Inventory Carrying Costs = (4,000/2)*.075*12% = $180 Order Costs = 44,000/4,000 = 11orders, 11orders*$8 per order = $88 Transportation Costs = 44,000*$0.04 per unit = $1760.00 (Q=4,000) = 180+88+1,760 = 2,028 2c. 4,000 CUPS = 11 orders, 33 days between orders 4a. Common days’ supply of chocolate chewies at DC: DS= [(42,000 – 7,000) + 18,500]/4,500 = 11.8888889 = 12(Rounded Up) 4b. Fair Share Allocation Logic: Cincinnati Allocation = (11.8888889 * 2,500) – 12,500 = 17,222.2222 Phoenix Allocation = (11.8888889 * 2,000) – 6,000 = 17,777.7778 6a. Yes. The demand never exceeded what was in stock and causing a stockout. 6b. SD = 1.811 6c. Yes. The frequency wasn’t out of bounds with mean, mode, median. 6d. SD = 1.095445 6e. SD of Combined Probabilities = 6 6g. f(k) = 0.061667 6h. k = 1.1, Required safety stock for the desired 99 percent is 6.42 with an average inventory of 36 6i....

Words: 252 - Pages: 2

Premium Essay

Economics Problems Set 1

...MBA-FP6008: Assessment 1, Economics Problem Set 1 Dennis J. Johnson Capella University 08/12/2015 Problems A, B, and C Introduction This assessment will be an analysis of graphed data and changes in supply and demand for three economic problems. Problem A involves production possibilities for consumer and capital goods, problem B is an evaluation of changes in supply and demand equilibrium, and finally, problem C involves pricing with relevance to supply and demand. Successful completion of this assessment demonstrates proficiency in; applying theories, models, and practices of economic theory, analyzing solutions with support from relevant data, resources, references, and economic principles, analyzing graphed and circular flow diagram data, and analyzing changes in supply and demand in a competitive market. Problem A. Production Possibilities | Type of Production | Production Alternative A | Production Alternative B | Production Alternative C | Production Alternative D | Production Alternative E | Butter | 0 | 1 | 2 | 3 | 4 | Guns | 15 | 14 | 12 | 9 | 0 | Production Possibilities for Consumer Goods (Guns) and Capital Goods (Butter) 1. The specific assumptions that underlie the production possibilities curve are: that there are only two goods, consumer and capital, that they are produced in different proportions in the economy, the quantities of the resources do not change, production techniques are given and constant, and that resources......

Words: 1353 - Pages: 6

Premium Essay

Problem Set 1

...Problem 1 a. What do you expect tuition and housing at top private schools to cost during Mary’s first year at college? PV=35,000; r=4%; N=18-5=13 FV=PV*(1+r)n =35,000*1+4%13 =58277.57 b. In nominal dollars, how much must be in the savings account on Mary’s 18th birthday after the last deposit has been made but before the first tuition and housing payment? PV18=58277.57; g=4%; r=10%*(1-τ)=10%*(1-30%)=7%; N=3 Pmt19=PV18*1+g=58277.57*1+4%=60608.67 The present value of year 18-21 at 18th year is: PV18-21=PV18+Pmt19r-g(1-(1+g1+r)N) =58277.57+60608.677%-4%1-1+4%1+7%3 =223488.53 c. What should be the amount of the first deposit to the savings account? FV=223488.53; r=10%*(1-τ)=10%*(1-30%)=7%; g=2%; N=18-5=13 Pmt1=FV1+rN-1+gNr-g =223488.531+7%13-1+2%137%-2% =10010.79 d. Alternatively, Mary’s parents could open a 529 account that allows college savings to grow tax-free. If they saved in this account rather than in a normal investment fund, and still earned the same pre-tax return, how much should be their first deposit? PV18=58277.57; g=4%; r=10%; N=3; Pmt19=PV18*1+g=58277.57*1+4%=60608.67 The present value of year 18-21 at 18th year is: PV18-21=PV18+Pmt19r-g(1-(1+g1+r)N) =58277.57+60608.6710%-4%1-1+4%1+10%3 =214721.71 FV=214721.71; r=10%; g=2%; N=18-5=13 Pmt1=FV1+rN-1+gNr-g =214721.711+10%13-1+2%1310%-2% =7957...

Words: 1347 - Pages: 6

Premium Essay

Problem Set 1

...Problem Set #1 Date 09/22/2015 Sayantani Nandy 1. Sign into Bloomberg and check IBM's page (IBM US Equity). Check Company Overview and then Company Management. Find the composition of the Management Team and the Board and check the backgrounds of the Chair as well as the top 3 longest serving board members. (a) How many of these three board members appear to be independent? (b) What are their compensations? (c) What other board memberships or executive positions do they hold? (d) Do you think having these positions help increase or reduce agency cost and help better align the interest of shareholders with management? Answer: I will start to answer the question with a table of summary: IBM Corp Inc. Sr. No Tenure . (yrs.) 1 2 Independent Board Member CompenCurrent sation shareholding Kenneth Chenault 17.8 "Ken" Other Board/Executive Positions Company Name Title Yes / No Bloomberg Philanthropists Board Member Presidents & Fellows of Harvard Board Member College Proctor & Gamble Company Board Member No American Express Travel related Chairman services Co. American Express Co. Chairman $341,193 $ 1,031,972 BM Corp. Board Member Sidney 14.8 Taurel BioCrossroads IBM McGraw Hill Financial Mc Grawhill, Compensation and Leadership Development IBM, Executive compensation $368,724 $ 2,284,797 and management resources Name Board Member Board Member Board Member No Chairman Chairman Yes 3 Joan......

Words: 2087 - Pages: 9

Premium Essay

Unit 1 Problem Set

...Networking Unit 1 Problem Set 1 Lesson 1 1. the general public in the United States will be able to purchase all of the Windows 7 editions in retail stores except... Starter, Home basic and Enterprise. 2. the core module that provides all of the Windows 7 capability that isn't language- or edition-specific is called... MinWin Module. 3. When you copy a file to a library, Windows Explorer writes the file to the folder designated as the … Save Location. 4. To use federated search, you must download or create XML files for specific sites called... Connectors. 5. The only operating system edition that you can upgrade in-place to Windows 7 Professional is... Windows 7 Ultimate. 6. Upgrading a computer running Windows 7 Starter to Windows 7 Ultimate using Windows Anytime Upgrade requires Blank megabytes of additional hard disk space. 0 7. to migrate a computer running Windows XP to Windows 7, you can use a utility called... Windows 7 Upgrade Advisor. 8. the new Windows 7 feature that renders all of the windows on the desktop transparent when you mouse over the right end of the taskbar is called... Aero Pack. 9. the Windows 7 Blank edition is only available in a 32-bit version. Starter 10. The maximum amount of system memory supported by Windows 7 Enterprise is... 192GB. Lesson 2 1. Windows Easy Transfer supports two types of migrations, called Blank and Blank. Wipe and Load & Side by Side 2. When a serious problem......

Words: 474 - Pages: 2

Premium Essay

Problem Set 1

...Problem set 1 Exercise 1 Giving €10 to a friend does not affect GDP because it is just an exchange of paper and there is no new production. Because she loses the money, she cannot go to the movies, so she cannot consume anything. That transaction does not affect France's 2014 GDP. Expenditure: consumption in services increase by €50 (only the service fee and not the loan). Income side: wages and profits should increase by €50. Value added: services value added should increase by €50. Expenditure: consumption in goods increases, but imports also increases. GDP stays the same. Income side: it does not increase in France but in the US. Value added: it increases in the US and not in France Winning the lotery is just a money transfer, it does not involve production, therefore it does not affect GDP. It is legalized so it should count in GDP and increase it, but because it is domestic production, it is not meant to be sold, so it does not affect GDP. Expenditure: consumption in non-durable goods increases by €105. Income side: wages plus profits shoul increase by €105. Value added: Restaurants value added should increase by €105. Exercise 4 (i) NominalGDP2012 = QuantityTV * PriceTV2012 + QuantityComputers * PriceComputers2012 = 100*500+20*1,000 NominalGDP2012= €70,000 NominalGDP2013 = QuantityTV * PriceTV2013 + QuantityComputers * PriceComputers2013 = 80*400+30*1,200 NominalGDP2013= €68,000 NominalGDP2014 = QuantityTV *......

Words: 930 - Pages: 4

Premium Essay

Problem Set 1

...Problem Set 5: 1) Advantages include the fact that polyclonal is cheaper, a mixture of different antibodies are made while monoclonal is only one specific antibody (this might depend on the experiment as some might prefer different antibodies), and large quantities are made. Disadvantages are that the affinities of the antibodies differ, a good amount of a specific antibody can’t be made alone unlike monoclonal, it is less reliable, and the same sample can’t be guaranteed each time unlike the monoclonal which can bring similar clones months later. 3) The GFP-HDAC3 overlaps the DAPI where the nucleus is. This shows that HDAC3 is a nuclear protein. However, some deletions show that the nucleus has gone smaller while others show that the nucleus has gone larger. The goal of this experiment was to find out how the different portions of the protein affected localization in the cell. The experiment does show that there was a significant effect. 4) Sense: 5’ aagccccatcgcctggcattg 3’ Linker Loop: 5’ uucaagaga 3’ Antisense: 5’ caatgccaggcgatggggctt 3’ Poly U: UUUUU The goal of the knockout would be to see if the removed proteins had any effect on the function of the cell. The siRNA should be 30%-50% GC content, 21 bp in length, have a AA on the 5’ end, a linker, around 75 bp ds of the gene, and have a poly U tail. These conditions are satisfied but the GC content is slightly high. 5) Fold increase in HDAC3 mRNA gene in control vs experiment = 1488/151= 9.85 fold......

Words: 364 - Pages: 2

Premium Essay

Problem Set 1

...Problem Set 1 Problem 1 Which project should the firm select? Why? Project B: Managers should try to maximize their stock’s intrinsic value while also bringing in revenue. The P/E ratio shows the dollar amount investors will pay for $1 of current earnings. Problem 2 If most investors expect the same cash flows from Companies A and B but are more confident that A’s cash flows will be closer to their expected value, which company should have the higher stock price? Explain. The primary goal of a corporation should be to maximize its owner’s value. If a manager is to maximize shareholder wealth, he/she must know how that wealth is determined. Fundamentally, shareholder wealth is the number of shares outstanding at times the market price per share. A stock’s price at any given time depends on the cash flows a “marginal” investor expects to receive after buying the stock. With that being said, Company A’s cash flow would increase the stock price and the risk would be minimal. Management’s goal should be to make decisions designed to maximize the stock’s price. Problem 3 The president of Southern Semiconductor Corporation (SSC) made this statement in the company’s annual report: “SSC’s primary goal is to increase the value of our common stock holders’ equity.” Later in the report, the following announcements were made: a. The company contributed $1.5 million to the symphony orchestra in Birmingham, Alabama, its headquarters city b. The company is spending $500......

Words: 628 - Pages: 3